19
FAQ Sections
Primer name Primer sequence Location Comments
SU1-For GTCTGAGCCTCCTTGTCTTG Begins ~270 bp upstream of
AvrII/BstZ17I insertion site
Forward primer for EF2/CMV
hybrid promoter ORF
SU1-Rev AGAAGACACGGGAGACTTAG Begins ~90 bp downstream
of AvrII/BstZ17I insertion site
Reverse primer for EF2/CMV
hybrid promoter ORF
SU2-For GGTGTCGTGAGGAATTTCAG Begins ~285 bp upstream of
EcoRV/PacI insertion site
Forward primer for CMV/EF1
hybrid promoter ORF
SU2-Rev GAGGCAGCCGGATCATAATC Begins ~250 bp downstream
of EcoRV/PacI insertion site
Reverse primer for CMV/EF1
hybrid promoter ORF
Life Technologies
™
| Freedom
®
CHO-S
®
Kit FAQ
Table 1. Primers for sequencing insertions into the Freedom
®
pCHO vector. Depending on the size of your
insert(s), you may also need to order insert-specific primers in order to completely sequence each insert prior
to transfection.
