19
Life Technologies
™
| lifetechnologies.com/parkinsons
To establish cell models to study the contribution of
α-synuclein deposits to other PD-relevant phenotypes,
we used GeneArt
®
Precision TALs to generate cell lines
with either a single copy or both copies of the SNCA gene
deleted. A TAL pair was designed to bind to exon 2 of SNCA,
targeting the start site of translation (Figure 7A).
The TAL pair was electroporated into the MSA donor
iPSCs, and the cells were plated onto a MEF feeder layer
for recovery. Out of 12 screened colonies, two were
identified as positive by the GeneArt
®
Genomic Cleavage
Detection assay (Figure 7B), which were further confirmed
by Sanger sequencing (data not shown). One colony
(colony 21) contained a population of cells with a 2 bp
deletion in codon 4 on one allele, which results in a
frameshift mutation that introduces a stop codon after
an 18 amino acid peptide. Another colony (colony 30) had
a 12 bp, in-frame deletion in one allele, so the resulting
protein would contain only a 4 amino acid deletion in its
protein sequence (unsuitable for our purposes). Colony 21
was further subcloned, and daughter colonies were again
screened by the cleavage detection assay (data not shown).
Generation of α-synuclein knockout lines
from the MSA line
Figure 7. Colony screening by GeneArt
®
Genomic Cleavage Detection Kit. (A) SNCA TAL
pair binding sites. (B) Genomic DNA was prepared from recovered iPSC colonies, followed
by a nested PCR over the SNCA region to be edited. The PCR product (~400 bp) was
denatured and re-annealed. If editing occurred, heteroduplexes were formed, which were
cleaved. Lanes lacking cleavage enzyme are shown with a minus symbol (–) and lanes
that were treated with cleavage enzyme are shown with a plus symbol (+). Samples from
colonies 21 and 30 have clearly visible cleavage products with desired sizes, indicating the
presence of a mismatch as a result of a TAL editing event.
A
B
340
350
290 300 310 320 330
Targeting exon 2 of SNCA
Forward SNCA TAL
Reverse SNCA TAL
GTGGTGTA A AGGA ATTCATTAGCATGGATGTATTCATGA A AGGACTTTCA A AGGCCA AGGGAGTT
Results
10 21 25 30 5
- + - + - + - + - +
